Stem-loop sequence hsa-mir-892b

AccessionMI0005538
Symbol HGNC:MIR892B
DescriptionHomo sapiens miR-892b stem-loop
Gene family MIPF0000386; mir-743
Stem-loop
   --u  aa   c             u    uuuau  a   u 
5'    gc  ugc cuacucagaaagg gcca     gu gau u
      ||  ||| ||||||||||||| ||||     || ||| u
3'    cg  acg gaugggucuuucc cggu     ca cug a
   acu  ga   a             u    -----  -   u 
Get sequence
Deep sequencing
4 reads, 32.3 reads per million, 5 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38) Overlapping transcripts
chrX: 145997198-145997274 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-892b
hsa-mir-891bchrX: 146001053-146001131 [-]
hsa-mir-892bchrX: 145997198-145997274 [-]
hsa-mir-892achrX: 145996669-145996743 [-]
hsa-mir-888chrX: 145994784-145994860 [-]
hsa-mir-890chrX: 145994275-145994351 [-]
hsa-mir-892cchrX: 145992750-145992826 [-]
Database links

Mature sequence hsa-miR-892b

Accession MIMAT0004918
Sequence

46 - 

cacuggcuccuuucuggguaga

 - 67

Get sequence
Evidence experimental; cloned [1]
Validated targets
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).