Stem-loop sequence hsa-mir-888

AccessionMI0005537 (change log)
Symbol HGNC:MIR888
DescriptionHomo sapiens miR-888 stem-loop
Gene family MIPF0000386; mir-743
Literature search

20 open access papers mention hsa-mir-888
(64 sentences)

Stem-loop
   --   ag g  c        a  c          uuag 
5'   ggc  u cu uacucaaa ag ugucagucac    a
     |||  | || |||||||| || ||||||||||    u
3'   ucg  a ga guggguuu uc acagucagug    u
   ac   ga g  a        c  c          uaca 
Get sequence
Deep sequencing
48814 reads, 785 reads per million, 59 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 145994784-145994860 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-888
hsa-mir-891bchrX: 146001053-146001131 [-]
hsa-mir-892bchrX: 145997198-145997274 [-]
hsa-mir-892achrX: 145996669-145996743 [-]
hsa-mir-888chrX: 145994784-145994860 [-]
hsa-mir-890chrX: 145994275-145994351 [-]
hsa-mir-892cchrX: 145992750-145992826 [-]
Database links

Mature sequence hsa-miR-888-5p

Accession MIMAT0004916
Previous IDshsa-miR-888
Sequence

11 - 

uacucaaaaagcugucaguca

 - 31

Get sequence
Deep sequencing46616 reads, 56 experiments
Evidence experimental; cloned [1]
Predicted targets

Mature sequence hsa-miR-888-3p

Accession MIMAT0004917
Previous IDshsa-miR-888*
Sequence

46 - 

gacugacaccucuuugggugaa

 - 67

Get sequence
Deep sequencing2190 reads, 14 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).