Stem-loop sequence hsa-mir-890

AccessionMI0005533 (change log)
Symbol HGNC:MIR890
DescriptionHomo sapiens miR-890 stem-loop
Gene family MIPF0000386; mir-743
Literature search

11 open access papers mention hsa-mir-890
(29 sentences)

Stem-loop
   --   ag   c     ug      c uc      uuag 
5'   gga  ugc cuacu  gaaagg a  aguugc    a
     |||  ||| |||||  |||||| |  ||||||    u
3'   ucu  aug gauga  cuuucc u  ucaaug    u
   au   ga   a     gu      c ua      uaca 
Get sequence
Deep sequencing
120 reads, 2.5 reads per million, 40 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 145994275-145994351 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-890
hsa-mir-891bchrX: 146001053-146001131 [-]
hsa-mir-892bchrX: 145997198-145997274 [-]
hsa-mir-892achrX: 145996669-145996743 [-]
hsa-mir-888chrX: 145994784-145994860 [-]
hsa-mir-890chrX: 145994275-145994351 [-]
hsa-mir-892cchrX: 145992750-145992826 [-]
Database links

Mature sequence hsa-miR-890

Accession MIMAT0004912
Sequence

11 - 

uacuuggaaaggcaucaguug

 - 31

Get sequence
Deep sequencing97 reads, 37 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).