Stem-loop sequence hsa-mir-874

AccessionMI0005532 (change log)
Symbol HGNC:MIR874
DescriptionHomo sapiens miR-874 stem-loop
Gene family MIPF0000401; mir-874
Literature search

23 open access papers mention hsa-mir-874
(214 sentences)

Stem-loop
   --      cug   c   a  ca        a   -a a 
5'   uuagcc   cgg ccc cg  ccagggua gag  g c
     ||||||   ||| ||| ||  |||||||| |||  | u
3'   ggucgg   gcc ggg gc  ggucccgu cuu  c c
   cg      uca   a   a  cc        c   cg u 
Get sequence
Deep sequencing
53608 reads, 23 reads per million, 152 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr5: 137647572-137647649 [-]
sense
OTTHUMT00000251281 ; CDC25C-002; intron 4
OTTHUMT00000373608 ; CDC25C-004; intron 5
OTTHUMT00000251280 ; CDC25C-001; intron 7
OTTHUMT00000373607 ; CDC25C-003; intron 7
OTTHUMT00000373609 ; CDC25C-005; intron 7
ENST00000415130 ; CDC25C-002; intron 4
ENST00000348983 ; CDC25C-201; intron 4
ENST00000514555 ; CDC25C-004; intron 5
ENST00000357274 ; CDC25C-203; intron 5
ENST00000356505 ; CDC25C-202; intron 6
ENST00000323760 ; CDC25C-001; intron 7
ENST00000513970 ; CDC25C-003; intron 7
ENST00000503022 ; CDC25C-005; intron 7
Database links

Mature sequence hsa-miR-874-5p

Accession MIMAT0026718
Sequence

10 - 

cggccccacgcaccaggguaaga

 - 32

Get sequence
Deep sequencing1845 reads, 104 experiments
Evidence experimental; Illumina [3]
Database links
Predicted targets

Mature sequence hsa-miR-874-3p

Accession MIMAT0004911
Sequence

47 - 

cugcccuggcccgagggaccga

 - 68

Get sequence
Deep sequencing51705 reads, 151 experiments
Evidence experimental; cloned [1-2], Illumina [3]
Database links
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).