Stem-loop sequence hsa-mir-874

Accession MI0005532
Symbol HGNC:MIR874
Description Homo sapiens miR-874 stem-loop
Gene family MIPF0000401; mir-874
Stem-loop 
--      cug   c   a  ca        a   -a a 
  uuagcc   cgg ccc cg  ccagggua gag  g c
  ||||||   ||| ||| ||  |||||||| |||  | u
  ggucgg   gcc ggg gc  ggucccgu cuu  c c
cg      uca   a   a  cc        c   cg u
Get sequence
Deep sequencing
112 reads, 20 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr5: 136983261-136983338 [-]
sense
OTTHUMT00000372240 ; KLHL3-008; intron 3
OTTHUMT00000372239 ; KLHL3-007; intron 3
OTTHUMT00000372240 ; KLHL3-008; intron 3
OTTHUMT00000372239 ; KLHL3-007; intron 3
OTTHUMT00000372240 ; KLHL3-008; intron 3
OTTHUMT00000372239 ; KLHL3-007; intron 3
OTTHUMT00000372236 ; KLHL3-004; intron 6
OTTHUMT00000372237 ; KLHL3-005; intron 6
OTTHUMT00000372236 ; KLHL3-004; intron 6
OTTHUMT00000372237 ; KLHL3-005; intron 6
OTTHUMT00000372236 ; KLHL3-004; intron 6
OTTHUMT00000372237 ; KLHL3-005; intron 6
OTTHUMT00000372234 ; KLHL3-002; intron 7
OTTHUMT00000372234 ; KLHL3-002; intron 7
OTTHUMT00000372234 ; KLHL3-002; intron 7
OTTHUMT00000372235 ; KLHL3-003; intron 8
OTTHUMT00000251220 ; KLHL3-001; intron 8
OTTHUMT00000372235 ; KLHL3-003; intron 8
OTTHUMT00000251220 ; KLHL3-001; intron 8
OTTHUMT00000372235 ; KLHL3-003; intron 8
OTTHUMT00000251220 ; KLHL3-001; intron 8
ENST00000506873 ; KLHL3-008; intron 3
ENST00000502381 ; KLHL3-007; intron 3
ENST00000506873 ; KLHL3-008; intron 3
ENST00000502381 ; KLHL3-007; intron 3
ENST00000506873 ; KLHL3-008; intron 3
ENST00000502381 ; KLHL3-007; intron 3
ENST00000506491 ; KLHL3-004; intron 6
ENST00000504208 ; KLHL3-005; intron 6
ENST00000541417 ; KLHL3-202; intron 6
ENST00000506491 ; KLHL3-004; intron 6
ENST00000504208 ; KLHL3-005; intron 6
ENST00000541417 ; KLHL3-202; intron 6
ENST00000506491 ; KLHL3-004; intron 6
ENST00000504208 ; KLHL3-005; intron 6
ENST00000541417 ; KLHL3-202; intron 6
ENST00000505853 ; KLHL3-002; intron 7
ENST00000505853 ; KLHL3-002; intron 7
ENST00000505853 ; KLHL3-002; intron 7
ENST00000508657 ; KLHL3-003; intron 8
ENST00000309755 ; KLHL3-001; intron 8
ENST00000508657 ; KLHL3-003; intron 8
ENST00000309755 ; KLHL3-001; intron 8
ENST00000508657 ; KLHL3-003; intron 8
ENST00000309755 ; KLHL3-001; intron 8
Database links

Mature sequence hsa-miR-874

Accession MIMAT0004911
Sequence

47 -  

cugcccuggcccgagggaccga

 - 68

Get sequence
Deep sequencing 99 reads, 18 experiments
Evidence experimental; cloned [1-2]
Validated targets
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).