Stem-loop sequence hsa-mir-450b

AccessionMI0005531
Symbol HGNC:MIR450B
DescriptionHomo sapiens miR-450b stem-loop
Gene family MIPF0000128; mir-450
Stem-loop
   --          uuu     u   u    g    ug aa 
5'   gcagaauuau   ugcaa aug uccu aaua  u  u
     ||||||||||   ||||| ||| |||| ||||  |  a
3'   uguuuugaua   acguu uac aggg uuau  g  u
   ua          ccu     u   u    -    gu aa 
Get sequence
Deep sequencing
2206 reads, 482 reads per million, 51 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38) Overlapping transcripts
chrX: 134540185-134540262 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-450b
hsa-mir-424chrX: 134546614-134546711 [-]
hsa-mir-503chrX: 134546328-134546398 [-]
hsa-mir-542chrX: 134541341-134541437 [-]
hsa-mir-450a-2chrX: 134540508-134540607 [-]
hsa-mir-450a-1chrX: 134540341-134540431 [-]
hsa-mir-450bchrX: 134540185-134540262 [-]
Database links

Mature sequence hsa-miR-450b-5p

Accession MIMAT0004909
Sequence

11 - 

uuuugcaauauguuccugaaua

 - 32

Get sequence
Deep sequencing456 reads, 43 experiments
Evidence experimental; cloned [1]
Predicted targets

Mature sequence hsa-miR-450b-3p

Accession MIMAT0004910
Sequence

48 - 

uugggaucauuuugcauccaua

 - 69

Get sequence
Deep sequencing42 reads, 19 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).