Stem-loop sequence hsa-mir-509-2

Accession MI0005530
Symbol HGNC:MIR509-2
Description Homo sapiens miR-509-2 stem-loop
Gene family MIPF0000130; mir-506
Stem-loop 
caugc   -   ug    c   - ug     a   g       --g  u 
     ugu gug  guac cua c  cagac gug caaucau   ua a
     ||| |||  |||| ||| |  ||||| ||| |||||||   ||  
     aca uac  caug gau g  gucug cau guuagua   au a
----c   g   gu    a   g gu     -   g       aaa  u
Get sequence
Deep sequencing
22958 reads, 13 experiments
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The cloned miR-509-5p sequence from [3] includes a 1 nt extension at the 3' end (A), which is incompatible with the genome sequence.

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chrX: 146340278-146340368 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-509-2
hsa-mir-509-1 chrX: 146342050-146342143 [-]
hsa-mir-509-3 chrX: 146341170-146341244 [-]
hsa-mir-509-2 chrX: 146340278-146340368 [-]
hsa-mir-514b chrX: 146331669-146331748 [-]
Database links

Mature sequence hsa-miR-509-5p

Accession MIMAT0004779
Sequence

20 -  

uacugcagacaguggcaauca

 - 40

Get sequence
Deep sequencing 18476 reads, 10 experiments
Evidence experimental; cloned [3]
Predicted targets

Mature sequence hsa-miR-509-3p

Accession MIMAT0002881
Previous IDs hsa-miR-509
Sequence

55 -  

ugauugguacgucuguggguag

 - 76

Get sequence
Deep sequencing 40943 reads, 13 experiments
Evidence experimental; array-cloned [1], cloned [2-3]
Validated targets
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:17573847 "Analysis of gene expression in normal and neoplastic human testis: new roles of RNA" Novotny GW, Nielsen JE, Sonne SB, Skakkebaek NE, Rajpert-De Meyts E, Leffers H Int J Androl. 30:316-326(2007).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).