Stem-loop sequence hsa-mir-892a

AccessionMI0005528 (change log)
Symbol HGNC:MIR892A
DescriptionHomo sapiens miR-892a stem-loop
Gene family MIPF0000386; mir-743
Literature search

9 open access papers mention hsa-mir-892a
(31 sentences)

Stem-loop
   gcagu         -----       u  -    c  uuac 
5'      gccuuacuc     agaaagg gc cagu ac    a
        |||||||||     ||||||| || |||| ||    c
3'      cggaaugag     ucuuucc ug guca ug    u
   ---cu         augcg       -  u    c  uaca 
Get sequence
Deep sequencing
110 reads, 0 reads per million, 44 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 145996669-145996743 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-892a
hsa-mir-891bchrX: 146001053-146001131 [-]
hsa-mir-892bchrX: 145997198-145997274 [-]
hsa-mir-892achrX: 145996669-145996743 [-]
hsa-mir-888chrX: 145994784-145994860 [-]
hsa-mir-890chrX: 145994275-145994351 [-]
hsa-mir-892cchrX: 145992750-145992826 [-]
Database links

Mature sequence hsa-miR-892a

Accession MIMAT0004907
Sequence

45 - 

cacuguguccuuucugcguag

 - 65

Get sequence
Deep sequencing64 reads, 31 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).