Stem-loop sequence mmu-mir-92b

AccessionMI0005521 (change log)
Symbol MGI:Mir92b
DescriptionMus musculus miR-92b stem-loop
Gene family MIPF0000013; mir-25
Literature search

83 open access papers mention mmu-mir-92b
(351 sentences)

Stem-loop
   ---  u    g     ga       u            uucuu 
5'    gg gggc ggagg  cgggacg ggugcaguguug     u
      || |||| |||||  ||||||| ||||||||||||     c
3'    cc cccg ccucc  gcccugc ucacguuauaac     c
   gcu  -    g     -g       -            cgucc 
Get sequence
Deep sequencing
3836576 reads, 8.37e+03 reads per million, 107 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr3: 89227116-89227198 [-]
intergenic
Database links

Mature sequence mmu-miR-92b-5p

Accession MIMAT0017278
Previous IDsmmu-miR-92b*
Sequence

11 - 

agggacgggacguggugcaguguu

 - 34

Get sequence
Deep sequencing3328 reads, 70 experiments
Evidence experimental; Illumina [3]
Database links
Predicted targets

Mature sequence mmu-miR-92b-3p

Accession MIMAT0004899
Previous IDsmmu-miR-92b
Sequence

52 - 

uauugcacucgucccggccucc

 - 73

Get sequence
Deep sequencing3833236 reads, 107 experiments
Evidence experimental; cloned [1], Illumina [2-3]
Database links
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
3
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).