Stem-loop sequence mmu-mir-654

AccessionMI0005520 (change log)
Symbol MGI:Mir654
DescriptionMus musculus miR-654 stem-loop
Gene family MIPF0000409; mir-654
Literature search

11 open access papers mention mmu-mir-654
(46 sentences)

Stem-loop
   ------     uaagu  gaa      aagcu     a      uguuu 
5'       cucgg     gg   gauggu     gcaga caugug     c
         |||||     ||   ||||||     ||||| ||||||      
3'       ggguu     cc   cuacca     cgucu guauac     u
   gucucu     ----u  --a      ---gu     -      uguac 
Get sequence
Deep sequencing
689 reads, 6.67 reads per million, 15 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr12: 109723218-109723301 [+]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-654
mmu-mir-329chr12: 109713481-109713577 [+]
mmu-mir-494chr12: 109715318-109715402 [+]
mmu-mir-679chr12: 109715577-109715650 [+]
mmu-mir-1193chr12: 109715671-109715791 [+]
mmu-mir-666chr12: 109717085-109717183 [+]
mmu-mir-543chr12: 109717258-109717333 [+]
mmu-mir-495chr12: 109718754-109718816 [+]
mmu-mir-667chr12: 109720006-109720097 [+]
mmu-mir-376cchr12: 109722718-109722803 [+]
mmu-mir-654chr12: 109723218-109723301 [+]
mmu-mir-376bchr12: 109723458-109723539 [+]
mmu-mir-376achr12: 109723781-109723848 [+]
mmu-mir-300chr12: 109724313-109724391 [+]
mmu-mir-381chr12: 109726822-109726896 [+]
mmu-mir-487bchr12: 109727333-109727414 [+]
mmu-mir-539chr12: 109728129-109728202 [+]
mmu-mir-544chr12: 109729325-109729402 [+]
Database links

Mature sequence mmu-miR-654-5p

Accession MIMAT0004897
Sequence

18 - 

ugguaagcugcagaacaugugu

 - 39

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mmu-miR-654-3p

Accession MIMAT0004898
Sequence

53 - 

uaugucugcugaccaucaccuu

 - 74

Get sequence
Deep sequencing685 reads, 12 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).