Stem-loop sequence mmu-mir-590

AccessionMI0005519 (change log)
Symbol MGI:Mir590
DescriptionMus musculus miR-590 stem-loop
Gene family MIPF0000418; mir-590
Literature search

29 open access papers mention mmu-mir-590
(384 sentences)

Stem-loop
   --       a  g       u       g     ua   u 
5'   agucaga au agcuuau cauaaaa ugcag  ugg g
     ||||||| || ||||||| ||||||| |||||  ||| a
3'   uuagucu ug ucgaaua guauuuu auguc  acu a
   ag       c  a       u       a     ua   g 
Get sequence
Deep sequencing
725 reads, 66.7 reads per million, 6 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mmu-miR-590-5p

Accession MIMAT0004895
Sequence

11 - 

gagcuuauucauaaaagugcag

 - 32

Get sequence
Deep sequencing210 reads, 5 experiments
Evidence experimental; cloned [1]
Predicted targets

Mature sequence mmu-miR-590-3p

Accession MIMAT0004896
Sequence

51 - 

uaauuuuauguauaagcuagu

 - 71

Get sequence
Deep sequencing513 reads, 3 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).