Stem-loop sequence mmu-mir-574

AccessionMI0005518 (change log)
Symbol MGI:Mir574
DescriptionMus musculus miR-574 stem-loop
Gene family MIPF0000419; mir-574
Literature search

38 open access papers mention mmu-mir-574
(231 sentences)

Stem-loop
   --            a u                 u u gc 
5'   ugcgggcgugug g gugugugugugagugug g c  u
     |||||||||||| | ||||||||||||||||| | |  c
3'   acgcccgcacac c cacacacguacucgcac c g  c
   gc            - -                 - u aa 
Get sequence
Deep sequencing
22653 reads, 2.09e+03 reads per million, 155 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr5: 64970318-64970395 [+]
sense
OTTMUST00000056873 ; Fam114a1-001; intron 1
ENSMUST00000031080 ; Fam114a1-001; intron 1
Database links

Mature sequence mmu-miR-574-5p

Accession MIMAT0004893
Sequence

11 - 

ugagugugugugugugagugugu

 - 33

Get sequence
Deep sequencing8898 reads, 151 experiments
Evidence experimental; cloned [1], Illumina [2]
Database links
Predicted targets

Mature sequence mmu-miR-574-3p

Accession MIMAT0004894
Sequence

47 - 

cacgcucaugcacacacccaca

 - 68

Get sequence
Deep sequencing13755 reads, 108 experiments
Evidence experimental; cloned [1], Illumina [2]
Database links
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).