Stem-loop sequence mmu-mir-568

AccessionMI0005517 (change log)
Symbol MGI:Mir568
DescriptionMus musculus miR-568 stem-loop
Gene family MIPF0000408; mir-568
Literature search

6 open access papers mention mmu-mir-568
(7 sentences)

Stem-loop
   -    -      a      aau           uc        u 
5'  acac uauauu uguaua   guauacacacu  uauauaug c
    |||| |||||| ||||||   |||||||||||  ||||||||  
3'  ugug auaugg acauau   uaugugugugg  guauauac c
   g    g      -      ---           -c        a 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr16: 43640655-43640737 [+]
sense
OTTMUST00000062820 ; Zbtb20-001; exon 15
ENSMUST00000114694 ; Zbtb20-001; exon 15
Database links

Mature sequence mmu-miR-568

Accession MIMAT0004892
Sequence

11 - 

auguauaaauguauacacac

 - 30

Get sequence
Evidence by similarity; MI0003574
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).