Stem-loop sequence mmu-mir-504

AccessionMI0005515 (change log)
Symbol MGI:Mir504
DescriptionMus musculus miR-504 stem-loop
Gene family MIPF0000437; mir-504
Literature search

20 open access papers mention mmu-mir-504
(169 sentences)

Stem-loop
   -uc    -            g     a    -a  u   a 
5'    cugu ugggagacccug ucugc cucu  uc gua a
      |||| |||||||||||| ||||| ||||  || |||  
3'    gaca acccuuugggac ggacg gagg  ag cau c
   gga    u            g     a    ga  u   u 
Get sequence
Deep sequencing
3182 reads, 2.82 reads per million, 71 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chrX: 59097658-59097736 [-]
sense
OTTMUST00000044387 ; Fgf13-001; intron 3
OTTMUST00000044388 ; Fgf13-002; intron 3
OTTMUST00000044394 ; Fgf13-008; intron 3
OTTMUST00000044392 ; Fgf13-006; intron 4
ENSMUST00000033473 ; Fgf13-001; intron 3
ENSMUST00000119306 ; Fgf13-008; intron 3
ENSMUST00000138503 ; Fgf13-002; intron 3
ENSMUST00000119833 ; Fgf13-006; intron 4
Database links

Mature sequence mmu-miR-504-5p

Accession MIMAT0004889
Previous IDsmmu-miR-504
Sequence

11 - 

agacccuggucugcacucuauc

 - 32

Get sequence
Deep sequencing3055 reads, 68 experiments
Evidence experimental; Illumina [2-3]
Database links
Predicted targets

Mature sequence mmu-miR-504-3p

Accession MIMAT0017277
Previous IDsmmu-miR-504*
Sequence

47 - 

agggagagcagggcaggguuuc

 - 68

Get sequence
Deep sequencing121 reads, 32 experiments
Evidence experimental; Illumina [3]
Database links
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
3
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).