Stem-loop sequence mmu-mir-493

AccessionMI0005514 (change log)
Symbol MGI:Mir493
DescriptionMus musculus miR-493 stem-loop
Gene family MIPF0000230; mir-493
Literature search

13 open access papers mention mmu-mir-493
(29 sentences)

Stem-loop
   -c  -        u            -        cauuuuu 
5'   gc cagggccu guacaugguagg cuuucauu       u
     || |||||||| |||||||||||| ||||||||        
3'   cg gucccgga cgugugucaucc ggaagugg       g
   ac  u        c            u        cuuacac 
Get sequence
Deep sequencing
5683 reads, 27.9 reads per million, 68 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr12: 109580233-109580315 [+]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-493
mmu-mir-673chr12: 109571990-109572080 [+]
mmu-mir-493chr12: 109580233-109580315 [+]
mmu-mir-337chr12: 109585789-109585885 [+]
mmu-mir-3544chr12: 109585813-109585873 [-]
mmu-mir-540chr12: 109586080-109586146 [+]
mmu-mir-665chr12: 109586314-109586407 [+]
mmu-mir-3070-1chr12: 109587943-109588031 [+]
mmu-mir-3070-2chr12: 109588592-109588680 [+]
Database links

Mature sequence mmu-miR-493-5p

Accession MIMAT0017276
Previous IDsmmu-miR-493*
Sequence

11 - 

uuguacaugguaggcuuuc

 - 29

Get sequence
Deep sequencing4194 reads, 56 experiments
Evidence experimental; 454 [3], Illumina [4]
Database links
Predicted targets

Mature sequence mmu-miR-493-3p

Accession MIMAT0004888
Previous IDsmmu-miR-493
Sequence

51 - 

ugaagguccuacugugugccagg

 - 73

Get sequence
Deep sequencing1484 reads, 52 experiments
Evidence experimental; Illumina [2,4]
Database links
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
3
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).