|
miRBase |
|
Stem-loop sequence mmu-mir-493 |
|||||
| Accession | MI0005514 | ||||
| Symbol | MGI:Mir493 | ||||
| Description | Mus musculus miR-493 stem-loop | ||||
| Gene family | MIPF0000230; mir-493 | ||||
| Stem-loop |
-c - u - cauuuuu gc cagggccu guacaugguagg cuuucauu u || |||||||| |||||||||||| |||||||| cg gucccgga cgugugucaucc ggaagugg g ac u c u cuuacac |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Clustered miRNAs | |||||
| Database links | |||||
Mature sequence mmu-miR-493-5p |
|
| Accession | MIMAT0017276 |
| Previous IDs | mmu-miR-493* |
| Sequence |
11 - uuguacaugguaggcuuuc - 29 |
| Deep sequencing | 1293 reads, 37 experiments |
| Evidence | experimental; 454 [3], Solexa [4] |
| Predicted targets |
|
Mature sequence mmu-miR-493-3p |
|
| Accession | MIMAT0004888 |
| Previous IDs | mmu-miR-493 |
| Sequence |
51 - ugaagguccuacugugugccagg - 73 |
| Deep sequencing | 2195 reads, 35 experiments |
| Evidence | experimental; Solexa [2,4] |
| Predicted targets |
|
References |
|
| 1 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
| 2 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
| 3 |
PMID:20668074
"Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68"
J Virol. 84:10266-10275(2010).
|
| 4 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|