Stem-loop sequence mmu-mir-467d

AccessionMI0005513 (change log)
Symbol MGI:Mir467d
DescriptionMus musculus miR-467d stem-loop
Gene family MIPF0000316; mir-467
Literature search

20 open access papers mention mmu-mir-467d
(63 sentences)

Stem-loop
   --c          --------aa   c c c             ua 
5'    cugugugcau          gug g g auguauaugcgug  u
      ||||||||||          ||| | | |||||||||||||  a
3'    gacacacgua          cac c c uacauauacguau  u
   aca          cacacacauc   a a a             uu 
Get sequence
Deep sequencing
40244 reads, 241 reads per million, 121 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr2: 10507630-10507714 [+]
sense
OTTMUST00000026263 ; Sfmbt2-001; intron 10
ENSMUST00000041105 ; Sfmbt2-001; intron 10
ENSMUST00000116594 ; Sfmbt2-201; intron 11
Clustered miRNAs
< 10kb from mmu-mir-467d
mmu-mir-467a-9chr2: 10498393-10498475 [+]
mmu-mir-466b-2chr2: 10498685-10498766 [+]
mmu-mir-669a-10chr2: 10498911-10498997 [+]
mmu-mir-669a-11chr2: 10501339-10501425 [+]
mmu-mir-467a-10chr2: 10503273-10503355 [+]
mmu-mir-466b-3chr2: 10503565-10503645 [+]
mmu-mir-669a-12chr2: 10503791-10503877 [+]
mmu-mir-467echr2: 10505721-10505807 [+]
mmu-mir-466pchr2: 10506006-10506094 [+]
mmu-mir-467dchr2: 10507630-10507714 [+]
mmu-mir-466achr2: 10507918-10507990 [+]
mmu-mir-297cchr2: 10509016-10509113 [+]
mmu-mir-669cchr2: 10509296-10509404 [+]
mmu-mir-669a-2chr2: 10510164-10510260 [+]
mmu-mir-297bchr2: 10511667-10511775 [+]
mmu-mir-466dchr2: 10511967-10512062 [+]
mmu-mir-669m-1chr2: 10512790-10512887 [+]
mmu-mir-669m-2chr2: 10513434-10513531 [+]
mmu-mir-466nchr2: 10513741-10513834 [+]
mmu-mir-669ochr2: 10514300-10514395 [+]
mmu-mir-466gchr2: 10514595-10514674 [+]
mmu-mir-466hchr2: 10514891-10514971 [+]
mmu-mir-297a-3chr2: 10515820-10515921 [+]
mmu-mir-466lchr2: 10516097-10516217 [+]
mmu-mir-297a-4chr2: 10517067-10517164 [+]
Database links

Mature sequence mmu-miR-467d-5p

Accession MIMAT0004886
Previous IDsmmu-miR-467d
Sequence

11 - 

uaagugcgcgcauguauaugcg

 - 32

Get sequence
Deep sequencing24410 reads, 100 experiments
Evidence experimental; cloned [1], Illumina [2-3]
Database links
Predicted targets

Mature sequence mmu-miR-467d-3p

Accession MIMAT0004887
Previous IDsmmu-miR-467d*
Sequence

47 - 

auauacauacacacaccuacac

 - 68

Get sequence
Deep sequencing15650 reads, 103 experiments
Evidence experimental; cloned [1], Illumina [2-3]
Database links
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
3
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).