Stem-loop sequence mmu-mir-466h

AccessionMI0005511 (change log)
Symbol MGI:Mir466h
DescriptionMus musculus miR-466h stem-loop
Gene family MIPF0000316; mir-467
Literature search

26 open access papers mention mmu-mir-466h
(62 sentences)

Stem-loop
   --ugua            ca     uu         ugaau 
5'       uauuugugugug  ugugc  guguguaug     a
         ||||||||||||  |||||  |||||||||     u
3'       guaaacacacac  acacg  cacgcauac     a
   acgaac            ac     --         uauau 
Get sequence
Deep sequencing
5180 reads, 3.06e+03 reads per million, 153 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr2: 10514891-10514971 [+]
sense
OTTMUST00000026263 ; Sfmbt2-001; intron 10
ENSMUST00000041105 ; Sfmbt2-001; intron 10
ENSMUST00000116594 ; Sfmbt2-201; intron 11
Clustered miRNAs
< 10kb from mmu-mir-466h
mmu-mir-467echr2: 10505721-10505807 [+]
mmu-mir-466pchr2: 10506006-10506094 [+]
mmu-mir-467dchr2: 10507630-10507714 [+]
mmu-mir-466achr2: 10507918-10507990 [+]
mmu-mir-297cchr2: 10509016-10509113 [+]
mmu-mir-669cchr2: 10509296-10509404 [+]
mmu-mir-669a-2chr2: 10510164-10510260 [+]
mmu-mir-297bchr2: 10511667-10511775 [+]
mmu-mir-466dchr2: 10511967-10512062 [+]
mmu-mir-669m-1chr2: 10512790-10512887 [+]
mmu-mir-669m-2chr2: 10513434-10513531 [+]
mmu-mir-466nchr2: 10513741-10513834 [+]
mmu-mir-669ochr2: 10514300-10514395 [+]
mmu-mir-466gchr2: 10514595-10514674 [+]
mmu-mir-466hchr2: 10514891-10514971 [+]
mmu-mir-297a-3chr2: 10515820-10515921 [+]
mmu-mir-466lchr2: 10516097-10516217 [+]
mmu-mir-297a-4chr2: 10517067-10517164 [+]
mmu-mir-669ichr2: 10517604-10517730 [+]
mmu-mir-669hchr2: 10518155-10518279 [+]
Database links

Mature sequence mmu-miR-466h-5p

Accession MIMAT0004884
Previous IDsmmu-miR-466h
Sequence

11 - 

ugugugcaugugcuugugugua

 - 32

Get sequence
Deep sequencing2633 reads, 92 experiments
Evidence experimental; cloned [1], 454 [2], Illumina [4]
Database links
Predicted targets

Mature sequence mmu-miR-466h-3p

Accession MIMAT0017274
Sequence

50 - 

uacgcacgcacacacacac

 - 68

Get sequence
Deep sequencing2486 reads, 141 experiments
Evidence experimental; 454 [3], Illumina [4]
Database links
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:17989215 "RNA sequence analysis defines Dicer's role in mouse embryonic stem cells" Calabrese JM, Seila AC, Yeo GW, Sharp PA Proc Natl Acad Sci U S A. 104:18097-18102(2007).
3
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).