Stem-loop sequence mmu-mir-466f-1

AccessionMI0005507 (change log)
Symbol MGI:Mir466f-1
DescriptionMus musculus miR-466f-1 stem-loop
Gene family MIPF0000316; mir-467
Literature search

28 open access papers mention mmu-mir-466f-1
(67 sentences)

Stem-loop
   --------------         u  c         c     c        au 
5'               caugugugu ua gugugugug augug augugugu  a
                 ||||||||| || ||||||||| ||||| ||||||||   
3'               guacacaca au cacacacac uacac uacauaua  u
   uauacacacacaac         c  a         a     a        ag 
Get sequence
Deep sequencing
12830 reads, 4.88e+03 reads per million, 164 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Landgraf et al. identify several offset sequences which map to the 3' arm of the miR-466f hairpin precursors [1]. One sequence consistent with all three putative hairpin loci is shown here.

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr2: 10466944-10467037 [+]
sense
OTTMUST00000026263 ; Sfmbt2-001; intron 10
ENSMUST00000041105 ; Sfmbt2-001; intron 10
ENSMUST00000116594 ; Sfmbt2-201; intron 11
Clustered miRNAs
< 10kb from mmu-mir-466f-1
mmu-mir-466mchr2: 10466663-10466746 [+]
mmu-mir-466f-1chr2: 10466944-10467037 [+]
mmu-mir-669fchr2: 10467229-10467349 [+]
mmu-mir-669echr2: 10467495-10467613 [+]
mmu-mir-669bchr2: 10467790-10467886 [+]
mmu-mir-669dchr2: 10468343-10468463 [+]
mmu-mir-466f-2chr2: 10468675-10468768 [+]
mmu-mir-669lchr2: 10468971-10469068 [+]
mmu-mir-669d-2chr2: 10471644-10471729 [+]
mmu-mir-466f-3chr2: 10471953-10472046 [+]
mmu-mir-297a-2chr2: 10472254-10472343 [+]
mmu-mir-466ochr2: 10472540-10472623 [+]
mmu-mir-467cchr2: 10473931-10474027 [+]
mmu-mir-466b-1chr2: 10474219-10474300 [+]
mmu-mir-669a-3chr2: 10474433-10474541 [+]
mmu-mir-669kchr2: 10475300-10475426 [+]
mmu-mir-467a-1chr2: 10476346-10476418 [+]
mmu-mir-466b-8chr2: 10476628-10476713 [+]
mmu-mir-669a-1chr2: 10476853-10476949 [+]
Database links

Mature sequence mmu-miR-466f-5p

Accession MIMAT0004881
Sequence

11 - 

uacgugugugugcaugugcaug

 - 32

Get sequence
Deep sequencing8511 reads, 90 experiments
Evidence experimental; cloned [1], Illumina [2]
Database links
Predicted targets

Mature sequence mmu-miR-466f-3p

Accession MIMAT0004882
Sequence

55 - 

cauacacacacacauacacac

 - 75

Get sequence
Deep sequencing56401 reads, 165 experiments
Evidence experimental; cloned [1], Illumina [2]
Database links
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).