Stem-loop sequence mmu-mir-466c-1

AccessionMI0005505 (change log)
Previous IDsmmu-mir-466c
Symbol MGI:Mir466c-1
DescriptionMus musculus miR-466c-1 stem-loop
Gene family MIPF0000208; mir-466
Literature search

27 open access papers mention mmu-mir-466c-1
(62 sentences)

Stem-loop
   --g          -g           c     ca      aau 
5'    uauauguguu  augugugugug augua  uaugug   a
      ||||||||||  ||||||||||| |||||  ||||||   u
3'    guauacacag  uacacacgcac uacau  auacau   g
   cga          aa           a     --      aua 
Get sequence
Deep sequencing
33820 reads, 135 reads per million, 103 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr2: 10481534-10481617 [+]
sense
OTTMUST00000026263 ; Sfmbt2-001; intron 10
ENSMUST00000180005 ; Mir466c-1-201; exon 1
ENSMUST00000041105 ; Sfmbt2-001; intron 10
ENSMUST00000116594 ; Sfmbt2-201; intron 11
Clustered miRNAs
< 10kb from mmu-mir-466c-1
mmu-mir-669d-2chr2: 10471644-10471729 [+]
mmu-mir-466f-3chr2: 10471953-10472046 [+]
mmu-mir-297a-2chr2: 10472254-10472343 [+]
mmu-mir-466ochr2: 10472540-10472623 [+]
mmu-mir-467cchr2: 10473931-10474027 [+]
mmu-mir-466b-1chr2: 10474219-10474300 [+]
mmu-mir-669a-3chr2: 10474433-10474541 [+]
mmu-mir-669kchr2: 10475300-10475426 [+]
mmu-mir-467a-1chr2: 10476346-10476418 [+]
mmu-mir-466b-8chr2: 10476628-10476713 [+]
mmu-mir-669a-1chr2: 10476853-10476949 [+]
mmu-mir-669gchr2: 10477150-10477272 [+]
mmu-mir-669jchr2: 10477910-10478030 [+]
mmu-mir-467a-2chr2: 10478798-10478880 [+]
mmu-mir-466echr2: 10479088-10479171 [+]
mmu-mir-669a-4chr2: 10479315-10479401 [+]
mmu-mir-467bchr2: 10481248-10481320 [+]
mmu-mir-466c-1chr2: 10481534-10481617 [+]
mmu-mir-669a-5chr2: 10481761-10481847 [+]
mmu-mir-467a-3chr2: 10483678-10483760 [+]
mmu-mir-466c-2chr2: 10483966-10484055 [+]
mmu-mir-669a-6chr2: 10484196-10484282 [+]
mmu-mir-467a-4chr2: 10486135-10486217 [+]
mmu-mir-466b-4chr2: 10486423-10486512 [+]
mmu-mir-669a-7chr2: 10486653-10486739 [+]
mmu-mir-467a-5chr2: 10488599-10488681 [+]
mmu-mir-466b-5chr2: 10488887-10488974 [+]
mmu-mir-669p-1chr2: 10489116-10489202 [+]
mmu-mir-467a-6chr2: 10491048-10491130 [+]
mmu-mir-466c-3chr2: 10491336-10491425 [+]
Database links

Mature sequence mmu-miR-466c-5p

Accession MIMAT0004877
Sequence

11 - 

ugaugugugugugcauguacauau

 - 34

Get sequence
Deep sequencing31110 reads, 95 experiments
Evidence experimental; Illumina [1]

Mature sequence mmu-miR-466c-3p

Accession MIMAT0004878
Sequence

52 - 

auacauacacgcacacauaaga

 - 73

Get sequence
Deep sequencing70338 reads, 102 experiments
Evidence experimental; Illumina [1]

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
3
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).