|
miRBase |
|
Mature sequence mmu-miR-466b-5p |
|
| Accession | MIMAT0004875 |
| Sequence |
10 - ugauguguguguacauguacau - 31 |
| Deep sequencing | 26392 reads, 71 experiments |
| Evidence | experimental; cloned [1], Solexa [2-3] |
| Predicted targets |
|
Mature sequence mmu-miR-466b-3p |
|
| Accession | MIMAT0004876 |
| Sequence |
51 - auacauacacgcacacauaaga - 72 |
| Deep sequencing | 49898 reads, 76 experiments |
| Evidence | experimental; cloned [1], Solexa [2-3] |
| Predicted targets |
|
References |
|
| 1 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
| 2 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
| 3 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|