Stem-loop sequence mmu-mir-465c-1

AccessionMI0005500 (change log)
Symbol MGI:Mir465c-1
DescriptionMus musculus miR-465c-1 stem-loop
Gene family MIPF0000384; mir-465
Literature search

8 open access papers mention mmu-mir-465c-1
(33 sentences)

Stem-loop
   --u  aa   c          u   g      ugaugaau 
5'    gc  ugc cuauuuagaa ggc cugauc        a
      ||  ||| |||||||||| ||| ||||||        a
3'    cg  aug gaugaaucuu ccg gacuag        a
   auu  ga   a          u   g      uaaaaaaa 
Get sequence
Deep sequencing
343925 reads, 2.81e+03 reads per million, 60 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chrX: 66825955-66826035 [-]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-465c-1
mmu-mir-465b-2chrX: 66835764-66835842 [-]
mmu-mir-465c-2chrX: 66832517-66832597 [-]
mmu-mir-465b-1chrX: 66829202-66829280 [-]
mmu-mir-465c-1chrX: 66825955-66826035 [-]
mmu-mir-465dchrX: 66822656-66822713 [-]
Database links

Mature sequence mmu-miR-465c-5p

Accession MIMAT0004873
Sequence

11 - 

uauuuagaauggcgcugaucug

 - 32

Get sequence
Deep sequencing297438 reads, 52 experiments
Evidence experimental; cloned [1], Illumina [2-3]
Database links
Predicted targets

Mature sequence mmu-miR-465c-3p

Accession MIMAT0004874
Sequence

50 - 

gaucagggccuuucuaaguaga

 - 71

Get sequence
Deep sequencing390258 reads, 50 experiments
Evidence experimental; cloned [1], Illumina [2-3]
Database links
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
3
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).