Stem-loop sequence mmu-mir-453

AccessionMI0005497 (change log)
Symbol MGI:Mir453
DescriptionMus musculus miR-453 stem-loop
Literature search

2 open access papers mention mmu-mir-453
(3 sentences)

Stem-loop
   --agaa        ag         aagu   a    - ug   
5'       gaugcagg  ugcugugag    gcc uccc c  gu 
         ||||||||  |||||||||    ||| |||| |  | a
3'       uuacguuc  gugauacuc    ugg aggg g  uc 
   aauuua        ga         -cgu   -    a gu   
Get sequence
Deep sequencing
5 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr12: 109735619-109735700 [+]
sense
OTTMUST00000113366 ; Mirg-004; intron 1
OTTMUST00000113367 ; Mirg-001; intron 1
OTTMUST00000113368 ; Mirg-005; intron 1
OTTMUST00000114051 ; Mirg-010; intron 6
OTTMUST00000114052 ; Mirg-009; intron 7
OTTMUST00000114049 ; Mirg-011; intron 10
ENSMUST00000182268 ; Mirg-004; intron 1
ENSMUST00000181543 ; Mirg-001; intron 1
ENSMUST00000183116 ; Mirg-005; intron 1
ENSMUST00000182185 ; Mirg-010; intron 6
ENSMUST00000182499 ; Mirg-009; intron 7
ENSMUST00000183144 ; Mirg-011; intron 10
Clustered miRNAs
< 10kb from mmu-mir-453
mmu-mir-381chr12: 109726822-109726896 [+]
mmu-mir-487bchr12: 109727333-109727414 [+]
mmu-mir-539chr12: 109728129-109728202 [+]
mmu-mir-544chr12: 109729325-109729402 [+]
mmu-mir-382chr12: 109733771-109733846 [+]
mmu-mir-134chr12: 109734139-109734209 [+]
mmu-mir-668chr12: 109734732-109734797 [+]
mmu-mir-485chr12: 109734902-109734974 [+]
mmu-mir-453chr12: 109735619-109735700 [+]
mmu-mir-154chr12: 109738433-109738498 [+]
mmu-mir-496achr12: 109739119-109739197 [+]
mmu-mir-377chr12: 109740510-109740577 [+]
mmu-mir-541chr12: 109742409-109742498 [+]
mmu-mir-409chr12: 109743158-109743236 [+]
mmu-mir-412chr12: 109743289-109743368 [+]
mmu-mir-369chr12: 109743418-109743496 [+]
mmu-mir-410chr12: 109743715-109743795 [+]
Database links

Mature sequence mmu-miR-453

Accession MIMAT0004870
Sequence

51 - 

agguugccucauagugagcuugca

 - 74

Get sequence
Evidence by similarity; MI0001727
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).