Stem-loop sequence mmu-mir-421

AccessionMI0005496 (change log)
Symbol MGI:Mir421
DescriptionMus musculus miR-421 stem-loop
Gene family MIPF0000098; mir-95
Literature search

19 open access papers mention mmu-mir-421
(40 sentences)

Stem-loop
   -  uu      -    uua            a   aaa 
5'  ca  guaggc cuca   aauguuuguuga uga   a
    ||  |||||| ||||   |||||||||||| |||   a
3'  gu  cguccg gggu   uuacagacaacu acu   u
   u  cu      c    uaa            -   aag 
Get sequence
Deep sequencing
27136 reads, 32.7 reads per million, 104 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chrX: 103572921-103572996 [-]
sense
OTTMUST00000044290 ; Thcytx-002; intron 9
OTTMUST00000044291 ; Thcytx-003; intron 10
OTTMUST00000044293 ; Thcytx-005; intron 10
OTTMUST00000044239 ; Thcytx-001; intron 10
ENSMUST00000083575 ; Mir421-201; exon 1
ENSMUST00000130063 ; Ftx-002; intron 9
ENSMUST00000156211 ; Ftx-001; intron 10
ENSMUST00000145803 ; Ftx-005; intron 10
ENSMUST00000156240 ; Ftx-003; intron 10
Clustered miRNAs
< 10kb from mmu-mir-421
mmu-mir-374cchrX: 103573085-103573133 [+]
mmu-mir-374bchrX: 103573060-103573154 [-]
mmu-mir-421chrX: 103572921-103572996 [-]
Database links

Mature sequence mmu-miR-421-5p

Accession MIMAT0017273
Previous IDsmmu-miR-421*
Sequence

11 - 

cucauuaaauguuuguugaau

 - 31

Get sequence
Deep sequencing121 reads, 40 experiments
Evidence experimental; Illumina [3]
Database links
Predicted targets

Mature sequence mmu-miR-421-3p

Accession MIMAT0004869
Previous IDsmmu-miR-421
Sequence

45 - 

aucaacagacauuaauugggcgc

 - 67

Get sequence
Deep sequencing27011 reads, 102 experiments
Evidence experimental; cloned [1], Illumina [2-3]
Database links
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
3
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).