Stem-loop sequence mmu-mir-344-2

AccessionMI0005495 (change log)
Symbol MGI:Mir344-2
DescriptionMus musculus miR-344-2 stem-loop
Gene family MIPF0000267; mir-344
Literature search

9 open access papers mention mmu-mir-344-2
(32 sentences)

Stem-loop
   ----uu     c         cc         uc        a 
5'       uuuac agucaggcu  uggcuagau  cagguacc a
         ||||| |||||||||  |||||||||  ||||||||  
3'       gaaug ucaguccga  accgaucua  guccaugg c
   aacguc     -         -a         --        u 
Get sequence
Deep sequencing
20850 reads, 87 reads per million, 54 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr7: 61940027-61940106 [-]
sense
ENSMUST00000181804 ; A330076H08Rik-203; intron 4
Database links

Mature sequence mmu-miR-344-5p

Accession MIMAT0017038
Previous IDsmmu-miR-344*
Sequence

9 - 

agucaggcuccuggcuagauuccagg

 - 34

Get sequence
Deep sequencing112 reads, 14 experiments
Evidence experimental; Illumina [3]
Database links
Predicted targets

Mature sequence mmu-miR-344-3p

Accession MIMAT0000593
Previous IDsmmu-miR-344
Sequence

49 - 

ugaucuagccaaagccugacugu

 - 71

Get sequence
Deep sequencing41588 reads, 54 experiments
Evidence experimental; cloned [1], Illumina [2-3]
Database links
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
3
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).