Stem-loop sequence mmu-mir-343

AccessionMI0005494 (change log)
Symbol MGI:Mir343
DescriptionMus musculus miR-343 stem-loop
Gene family MIPF0000411; mir-343
Literature search

3 open access papers mention mmu-mir-343
(3 sentences)

Stem-loop
   -----u     agag     --    c     uagcagagccc   g 
5'       gggau    ugggu  gugg ggggg           agg c
         |||||    |||||  |||| |||||           |||  
3'       uccua    acccg  uacu cccuc           ucc a
   cguacg     ---g     ug    u     -----------   a 
Get sequence
Deep sequencing
3 reads, 150 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr7: 19386643-19386717 [+]
sense
OTTMUST00000056022 ; Ercc2-002; intron 1
OTTMUST00000056024 ; Ercc2-004; 3'UTR (exon 5)
OTTMUST00000056023 ; Ercc2-003; 3'UTR (exon 7)
OTTMUST00000056021 ; Ercc2-001; 3'UTR (exon 8)
ENSMUST00000108461 ; Ercc2-002; intron 1
ENSMUST00000129249 ; Ercc2-004; 3'UTR (exon 5)
ENSMUST00000108460 ; Ercc2-003; 3'UTR (exon 7)
ENSMUST00000062831 ; Ercc2-001; 3'UTR (exon 8)
antisense
ENSMUST00000180691 ; Gm26852-201; intron 1
Database links

Mature sequence mmu-miR-343

Accession MIMAT0004868
Sequence

46 - 

ucucccuucaugugcccaga

 - 65

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence by similarity; MI0000628
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).