Stem-loop sequence mmu-mir-327

AccessionMI0005493 (change log)
Symbol MGI:Mir327
DescriptionMus musculus miR-327 stem-loop
Gene family MIPF0000438; mir-327
Literature search

4 open access papers mention mmu-mir-327
(145 sentences)

Stem-loop
   ugcccuuauaacuugaggggcaugaggaua  -    a  -   a  uc 
5'                               gu cagu gu cca ca  c
                                 || |||| || ||| ||  c
3'                               ca guua ca ggu gu  u
   -----------------------------a  c    -  c   a  uc 
Get sequence
Deep sequencing
4 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr14: 44947443-44947511 [-]
antisense
OTTMUST00000093317 ; RP23-13H15.4-001; intron 2
OTTMUST00000093318 ; RP23-13H15.4-002; intron 2
ENSMUST00000099718 ; Gm16976-001; intron 2
ENSMUST00000127408 ; Gm16976-002; intron 2
Database links

Mature sequence mmu-miR-327

Accession MIMAT0004867
Sequence

11 - 

acuugaggggcaugaggau

 - 29

Get sequence
Deep sequencing3 reads, 3 experiments
Evidence by similarity; MI0000600
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).