Stem-loop sequence mmu-mir-297a-4

AccessionMI0005489 (change log)
Symbol MGI:Mir297a-4
DescriptionMus musculus miR-297a-4 stem-loop
Gene family MIPF0000204; mir-297
Literature search

12 open access papers mention mmu-mir-297a-4
(15 sentences)

Stem-loop
   --c         a   a       ----------     ca            ag 
5'    uguguguau ugu ugugugc          augug  uguguguauaug  u
      ||||||||| ||| |||||||          |||||  ||||||||||||   
3'    acgcacaua aca acguacg          uacac  acauacauauac  a
   aaa         a   c       aacauaccca     --            au 
Get sequence
Deep sequencing
18271 reads, 997 reads per million, 115 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr2: 10517067-10517164 [+]
sense
OTTMUST00000026263 ; Sfmbt2-001; intron 10
ENSMUST00000041105 ; Sfmbt2-001; intron 10
ENSMUST00000116594 ; Sfmbt2-201; intron 11
Clustered miRNAs
< 10kb from mmu-mir-297a-4
mmu-mir-467dchr2: 10507630-10507714 [+]
mmu-mir-466achr2: 10507918-10507990 [+]
mmu-mir-297cchr2: 10509016-10509113 [+]
mmu-mir-669cchr2: 10509296-10509404 [+]
mmu-mir-669a-2chr2: 10510164-10510260 [+]
mmu-mir-297bchr2: 10511667-10511775 [+]
mmu-mir-466dchr2: 10511967-10512062 [+]
mmu-mir-669m-1chr2: 10512790-10512887 [+]
mmu-mir-669m-2chr2: 10513434-10513531 [+]
mmu-mir-466nchr2: 10513741-10513834 [+]
mmu-mir-669ochr2: 10514300-10514395 [+]
mmu-mir-466gchr2: 10514595-10514674 [+]
mmu-mir-466hchr2: 10514891-10514971 [+]
mmu-mir-297a-3chr2: 10515820-10515921 [+]
mmu-mir-466lchr2: 10516097-10516217 [+]
mmu-mir-297a-4chr2: 10517067-10517164 [+]
mmu-mir-669ichr2: 10517604-10517730 [+]
mmu-mir-669hchr2: 10518155-10518279 [+]
Database links

Mature sequence mmu-miR-297a-5p

Accession MIMAT0000375
Previous IDsmmu-miR-297;mmu-miR-297a
Sequence

11 - 

auguaugugugcaugugcaugu

 - 32

Get sequence
Deep sequencing44321 reads, 109 experiments
Evidence experimental; cloned [1], Illumina [2-3]
Database links
Predicted targets

Mature sequence mmu-miR-297a-3p

Accession MIMAT0004864
Previous IDsmmu-miR-297a*
Sequence

50 - 

uauacauacacacauacccaua

 - 71

Get sequence
Deep sequencing13800 reads, 94 experiments
Evidence experimental; cloned [1], Illumina [2-3]
Database links
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
3
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).