Stem-loop sequence mmu-mir-193b

AccessionMI0005484 (change log)
Symbol MGI:Mir193b
DescriptionMus musculus miR-193b stem-loop
Gene family MIPF0000082; mir-193
Literature search

67 open access papers mention mmu-mir-193b
(317 sentences)

Stem-loop
   -     -    u    gu    a    g  a  ag uug 
5'  ggccc agaa cggg  uuug gggc ag ug  u   u
    ||||| |||| ||||  |||| |||| || ||  |   g
3'  cuggg uuuu gccc  aaac cccg uc ac  a   u
   a     g    c    ug    a    g  a  cu uuu 
Get sequence
Deep sequencing
42794 reads, 260 reads per million, 102 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr16: 13449523-13449601 [+]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-193b
mmu-mir-193bchr16: 13449523-13449601 [+]
mmu-mir-365-1chr16: 13453840-13453926 [+]
Database links

Mature sequence mmu-miR-193b-5p

Accession MIMAT0017271
Previous IDsmmu-miR-193b*
Sequence

11 - 

cgggguuuugagggcgagauga

 - 32

Get sequence
Deep sequencing3384 reads, 77 experiments
Evidence experimental; Illumina [3]
Database links
Predicted targets

Mature sequence mmu-miR-193b-3p

Accession MIMAT0004859
Previous IDsmmu-miR-193b
Sequence

48 - 

aacuggcccacaaagucccgcu

 - 69

Get sequence
Deep sequencing39409 reads, 101 experiments
Evidence experimental; cloned [1], Illumina [2-3]
Database links
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
3
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).