Stem-loop sequence mmu-mir-18b

AccessionMI0005483 (change log)
Symbol MGI:Mir18b
DescriptionMus musculus miR-18b stem-loop
Gene family MIPF0000001; mir-17
Literature search

60 open access papers mention mmu-mir-18b
(144 sentences)

Stem-loop
   ucu       --u    u    c   ugcuguuagugaagc 
5'    cuugugu   aagg gcau uag               a
      |||||||   |||| |||| |||               g
3'    ggacacg   uucc cgua auc               c
   auc       cuc    c    a   ccgucaucuaacauu 
Get sequence
Deep sequencing
98726 reads, 767 reads per million, 105 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chrX: 52742331-52742413 [-]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-18b
mmu-mir-106achrX: 52742503-52742567 [-]
mmu-mir-18bchrX: 52742331-52742413 [-]
mmu-mir-20bchrX: 52742113-52742192 [-]
mmu-mir-19b-2chrX: 52741983-52742066 [-]
mmu-mir-92a-2chrX: 52741838-52741928 [-]
mmu-mir-363chrX: 52741693-52741767 [-]
Database links

Mature sequence mmu-miR-18b-5p

Accession MIMAT0004858
Previous IDsmmu-miR-18b
Sequence

11 - 

uaaggugcaucuagugcuguuag

 - 33

Get sequence
Deep sequencing94125 reads, 104 experiments
Evidence experimental; cloned [1], Illumina [2]
Database links
Predicted targets

Mature sequence mmu-miR-18b-3p

Accession MIMAT0017270
Previous IDsmmu-miR-18b*
Sequence

51 - 

uacugcccuaaaugccccuucu

 - 72

Get sequence
Deep sequencing693 reads, 48 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).