Stem-loop sequence mmu-mir-147

Accession MI0005482
Symbol MGI:Mir147
Description Mus musculus miR-147 stem-loop
Gene family MIPF0000105; mir-147
Stem-loop 
--  ug   c   ug   a            --------   u 
  ua  aau uag  gaa cauuucugcaca        aac a
  ||  ||| |||  ||| ||||||||||||        ||| g
  au  uua auc  cuu guaaaggcgugu        uug a
gg  gu   c   gu   c            gaccguag   u
Get sequence
Deep sequencing
16234 reads, 87 experiments
Genome context
Coordinates (GRCm38) Overlapping transcripts
chr2: 122640803-122640881 [+]
sense
OTTMUST00000110462 ; RP23-101F14.3-004; exon 3
OTTMUST00000037240 ; RP23-101F14.3-002; exon 4
OTTMUST00000037239 ; RP23-101F14.3-001; exon 5
ENSMUST00000175727 ; AA467197-004; exon 3
ENSMUST00000110512 ; AA467197-002; exon 4
ENSMUST00000047498 ; AA467197-001; exon 5
Database links

Mature sequence mmu-miR-147-5p

Accession MIMAT0017269
Previous IDs mmu-miR-147*
Sequence

12 -  

uggaaacauuucugcacaaacuag

 - 35

Get sequence
Deep sequencing 766 reads, 31 experiments
Evidence experimental; Solexa [3]
Predicted targets

Mature sequence mmu-miR-147-3p

Accession MIMAT0004857
Previous IDs mmu-miR-147
Sequence

48 -  

gugugcggaaaugcuucugcua

 - 69

Get sequence
Deep sequencing 14552 reads, 71 experiments
Evidence experimental; cloned [1], Solexa [2-3]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
3
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).