Stem-loop sequence mmu-mir-105

AccessionMI0005481 (change log)
Symbol MGI:Mir105
DescriptionMus musculus miR-105 stem-loop
Gene family MIPF0000074; mir-105
Literature search

9 open access papers mention mmu-mir-105
(108 sentences)

Stem-loop
   -----   auuu    caa        au  uug g    c   u 
5'      ugc    uagc   gugcucag  gc   u gugg ugc u
        |||    ||||   ||||||||  ||   | |||| |||  
3'      aug    aucg   uacgaguu  cg   a cacc acg a
   caucc   --gu    -ug        --  -ua g    -   u 
Get sequence
Deep sequencing
5 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chrX: 72591500-72591579 [-]
sense
OTTMUST00000043200 ; Gabra3-001; intron 1
OTTMUST00000043201 ; Gabra3-002; intron 1
OTTMUST00000043202 ; Gabra3-003; intron 1
ENSMUST00000055966 ; Gabra3-001; intron 1
ENSMUST00000114554 ; Gabra3-002; intron 1
ENSMUST00000137517 ; Gabra3-003; intron 1
Clustered miRNAs
< 10kb from mmu-mir-105
mmu-mir-105chrX: 72591500-72591579 [-]
mmu-mir-767chrX: 72589988-72590094 [-]
Database links

Mature sequence mmu-miR-105

Accession MIMAT0004856
Sequence

11 - 

ccaagugcucagaugcuuguggu

 - 33

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).