Stem-loop sequence mmu-mir-876

AccessionMI0005480 (change log)
Symbol MGI:Mir876
DescriptionMus musculus miR-876 stem-loop
Gene family MIPF0000430; mir-876
Literature search

4 open access papers mention mmu-mir-876
(35 sentences)

Stem-loop
   ucac ug         u  c             au  aa 
5'     g  cuauggauu cu ugugaaucacuau  ca  u
       |  ||||||||| || |||||||||||||  ||  c
3'     c  gauacuuaa ga acauuuggugaug  gu  u
   acuu gu         u  a             gu  ga 
Get sequence
Deep sequencing
40 reads, 14.3 reads per million, 14 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr4: 36645373-36645453 [-]
sense
OTTMUST00000014873 ; Lingo2-001; intron 2
OTTMUST00000014888 ; Lingo2-005; intron 2
ENSMUST00000108122 ; Lingo2-001; intron 2
ENSMUST00000124999 ; Lingo2-005; intron 2
Database links

Mature sequence mmu-miR-876-5p

Accession MIMAT0004854
Sequence

11 - 

uggauuucucugugaaucacua

 - 32

Get sequence
Deep sequencing25 reads, 11 experiments
Evidence experimental; cloned [1], Illumina [2-3]
Database links
Predicted targets

Mature sequence mmu-miR-876-3p

Accession MIMAT0004855
Sequence

50 - 

uagugguuuacaaaguaauuca

 - 71

Get sequence
Deep sequencing13 reads, 2 experiments
Evidence experimental; Illumina [2-3]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
3
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).