Stem-loop sequence mmu-mir-190b

AccessionMI0005478 (change log)
Symbol MGI:Mir190b
DescriptionMus musculus miR-190b stem-loop
Gene family MIPF0000076; mir-190
Literature search

22 open access papers mention mmu-mir-190b
(87 sentences)

Stem-loop
   --    u     u  -             g     -  aaa 
5'   ugcu cugug ga uauguuugauauu gguug uu   u
     |||| ||||| || ||||||||||||| ||||| ||    
3'   auga gacac cu auacgaacuguaa ucaac aa   u
   ga    c     u  c             g     c  gua 
Get sequence
Deep sequencing
2805 reads, 1.02 reads per million, 98 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr3: 90070020-90070099 [+]
intergenic
Database links

Mature sequence mmu-miR-190b-5p

Accession MIMAT0004852
Previous IDsmmu-miR-190b
Sequence

11 - 

ugauauguuugauauuggguug

 - 32

Get sequence
Deep sequencing2493 reads, 97 experiments
Evidence experimental; cloned [1], Illumina [2-3]
Database links
Predicted targets

Mature sequence mmu-miR-190b-3p

Accession MIMAT0017267
Previous IDsmmu-miR-190b*
Sequence

48 - 

acugaaugucaagcauacucuca

 - 70

Get sequence
Deep sequencing310 reads, 62 experiments
Evidence experimental; Illumina [3]
Database links
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
3
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).