|
miRBase |
|
Stem-loop sequence mmu-mir-190b |
|||||
| Accession | MI0005478 | ||||
| Symbol | MGI:Mir190b | ||||
| Description | Mus musculus miR-190b stem-loop | ||||
| Gene family | MIPF0000076; mir-190 | ||||
| Stem-loop |
-- u u - g - aaa ugcu cugug ga uauguuugauauu gguug uu u |||| ||||| || ||||||||||||| ||||| || auga gacac cu auacgaacuguaa ucaac aa u ga c u c g c gua |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Database links | |||||
Mature sequence mmu-miR-190b-5p |
|
| Accession | MIMAT0004852 |
| Previous IDs | mmu-miR-190b |
| Sequence |
11 - ugauauguuugauauuggguu - 31 |
| Deep sequencing | 1465 reads, 73 experiments |
| Evidence | experimental; cloned [1], Solexa [2-3] |
| Predicted targets |
|
Mature sequence mmu-miR-190b-3p |
|
| Accession | MIMAT0017267 |
| Previous IDs | mmu-miR-190b* |
| Sequence |
48 - acugaaugucaagcauacucuca - 70 |
| Deep sequencing | 271 reads, 50 experiments |
| Evidence | experimental; Solexa [3] |
| Predicted targets |
|
References |
|
| 1 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
| 2 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
| 3 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|