Stem-loop sequence mmu-mir-882

AccessionMI0005475 (change log)
Symbol MGI:Mir882
DescriptionMus musculus miR-882 stem-loop
Literature search

5 open access papers mention mmu-mir-882
(11 sentences)

Stem-loop
   --c      acca       g    cgc     ug aau 
5'    agcagu    ggagaga uuag   auuag  c   a
      ||||||    ||||||| ||||   |||||  |    
3'    ucgucg    ucuuuuu gguc   uaguc  g   g
   uuc      guaa       g    -uu     cu auu 
Get sequence
Deep sequencing
4 reads, 33.3 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr12: 109682197-109682273 [+]
intergenic
Database links

Mature sequence mmu-miR-882

Accession MIMAT0004847
Sequence

11 - 

aggagagaguuagcgcauuagu

 - 32

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).