Stem-loop sequence mmu-mir-880

AccessionMI0005473 (change log)
Symbol MGI:Mir880
DescriptionMus musculus miR-880 stem-loop
Gene family MIPF0000433; mir-880
Literature search

4 open access papers mention mmu-mir-880
(5 sentences)

Stem-loop
   --   ac   aa        -uu   au    c  uuccu 
5'   ugc  ugc  uacucaga   gau  gagu ac     a
     |||  |||  ||||||||   |||  |||| ||      
3'   acg  aug  augagucu   cua  cuca ug     u
   ac   ga   ag        cuc   -c    u  uacgu 
Get sequence
Deep sequencing
68870 reads, 867 reads per million, 46 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chrX: 66800530-66800607 [-]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-880
mmu-mir-871chrX: 66810428-66810504 [-]
mmu-mir-881chrX: 66801944-66802021 [-]
mmu-mir-878chrX: 66801508-66801585 [-]
mmu-mir-880chrX: 66800530-66800607 [-]
mmu-mir-463chrX: 66799223-66799297 [-]
mmu-mir-741chrX: 66796805-66796875 [-]
mmu-mir-471chrX: 66792595-66792661 [-]
Database links

Mature sequence mmu-miR-880-5p

Accession MIMAT0017266
Previous IDsmmu-miR-880*
Sequence

11 - 

uacucagauugauaugaguca

 - 31

Get sequence
Deep sequencing25 reads, 7 experiments
Evidence experimental; Illumina [4]
Predicted targets

Mature sequence mmu-miR-880-3p

Accession MIMAT0004844
Previous IDsmmu-miR-880
Sequence

47 - 

uacuccauccucucugaguaga

 - 68

Get sequence
Deep sequencing68845 reads, 46 experiments
Evidence experimental; cloned [1], 454 [2], Illumina [3-4]
Database links
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:17989215 "RNA sequence analysis defines Dicer's role in mouse embryonic stem cells" Calabrese JM, Seila AC, Yeo GW, Sharp PA Proc Natl Acad Sci U S A. 104:18097-18102(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).