Stem-loop sequence mmu-mir-879

AccessionMI0005472 (change log)
Symbol MGI:Mir879
DescriptionMus musculus miR-879 stem-loop
Gene family MIPF0000421; mir-879
Literature search

5 open access papers mention mmu-mir-879
(24 sentences)

Stem-loop
   --      g   ag      au    c        gga 
5'   uucuag ucc  aggcuu  agcu uaagccuu   u
     |||||| |||  ||||||  |||| ||||||||    
3'   gagguc agg  uucgaa  ucgg auucggag   g
   ca      g   cu      cu    u        aaa 
Get sequence
Deep sequencing
6308 reads, 10.3 reads per million, 58 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr5: 9375704-9375779 [+]
sense
OTTMUST00000063544 ; AC157555.1-001; intron 1
OTTMUST00000063545 ; AC157555.1-002; intron 1
OTTMUST00000063546 ; AC157555.1-003; intron 1
OTTMUST00000063547 ; AC157555.1-004; intron 1
OTTMUST00000063548 ; AC157555.1-005; intron 1
OTTMUST00000063549 ; AC157555.1-006; intron 1
OTTMUST00000063550 ; AC157555.1-007; intron 1
ENSMUST00000154662 ; 9330182L06Rik-007; intron 1
ENSMUST00000115348 ; 9330182L06Rik-002; intron 1
ENSMUST00000134991 ; 9330182L06Rik-006; intron 1
ENSMUST00000069538 ; 9330182L06Rik-001; intron 1
ENSMUST00000131626 ; 9330182L06Rik-004; intron 1
ENSMUST00000152095 ; 9330182L06Rik-003; intron 1
ENSMUST00000155764 ; 9330182L06Rik-005; intron 1
Database links

Mature sequence mmu-miR-879-5p

Accession MIMAT0004842
Previous IDsmmu-miR-879
Sequence

11 - 

agaggcuuauagcucuaagcc

 - 31

Get sequence
Deep sequencing5650 reads, 55 experiments
Evidence experimental; cloned [1], Illumina [2-3]
Database links
Predicted targets

Mature sequence mmu-miR-879-3p

Accession MIMAT0004843
Previous IDsmmu-miR-879*
Sequence

45 - 

gcuuauggcuucaagcuuucgg

 - 66

Get sequence
Deep sequencing651 reads, 31 experiments
Evidence experimental; cloned [1], Illumina [2-3]
Database links
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
3
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).