Stem-loop sequence mmu-mir-871

AccessionMI0005471 (change log)
Symbol MGI:Mir871
DescriptionMus musculus miR-871 stem-loop
Gene family MIPF0000386; mir-743
Literature search

4 open access papers mention mmu-mir-871
(9 sentences)

Stem-loop
   --u   g   uc        uua              a 
5'    gca ugc  uauucaga   gugccagucaugug a
      ||| |||  ||||||||   |||||||||||||| a
3'    cgu aug  auaggucu   cacggucaguauac u
   acu   a   ua        uac              a 
Get sequence
Deep sequencing
484711 reads, 6.22e+03 reads per million, 45 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chrX: 66810428-66810504 [-]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-871
mmu-mir-470chrX: 66813951-66814025 [-]
mmu-mir-871chrX: 66810428-66810504 [-]
mmu-mir-881chrX: 66801944-66802021 [-]
mmu-mir-878chrX: 66801508-66801585 [-]
mmu-mir-880chrX: 66800530-66800607 [-]
Database links

Mature sequence mmu-miR-871-5p

Accession MIMAT0004841
Previous IDsmmu-miR-871
Sequence

11 - 

uauucagauuagugccagucaug

 - 33

Get sequence
Deep sequencing25523 reads, 31 experiments
Evidence experimental; cloned [1], 454 [2], Illumina [3-4]
Database links
Predicted targets

Mature sequence mmu-miR-871-3p

Accession MIMAT0017265
Sequence

45 - 

ugacuggcaccauucuggauaau

 - 67

Get sequence
Deep sequencing459188 reads, 45 experiments
Evidence experimental; Illumina [4]
Database links
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:17989215 "RNA sequence analysis defines Dicer's role in mouse embryonic stem cells" Calabrese JM, Seila AC, Yeo GW, Sharp PA Proc Natl Acad Sci U S A. 104:18097-18102(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).