Stem-loop sequence bta-mir-99b

AccessionMI0005469 (change log)
DescriptionBos taurus miR-99b stem-loop
Gene family MIPF0000033; mir-10
Literature search

21 open access papers mention bta-mir-99b
(44 sentences)

Stem-loop
        cc         ac   c    c - -   c 
5' ggcac  acccguaga  cga cuug g g ggc u
   |||||  |||||||||  ||| |||| | | |||  
3' cugug  ugggugucu  gcu gaac c c ccg u
        cc         gu   c    a a g   c 
Get sequence
Deep sequencing
121320 reads, 1.4e+03 reads per million, 77 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr18: 58266580-58266649 [+]
intergenic
Clustered miRNAs
< 10kb from bta-mir-99b
bta-mir-99bchr18: 58266580-58266649 [+]
bta-let-7echr18: 58266748-58266826 [+]
bta-mir-125achr18: 58267247-58267332 [+]
Database links

Mature sequence bta-miR-99b

Accession MIMAT0004345
Sequence

7 - 

cacccguagaaccgaccuugcg

 - 28

Get sequence
Deep sequencing120120 reads, 77 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1