Stem-loop sequence bta-mir-660

AccessionMI0005468 (change log)
DescriptionBos taurus miR-660 stem-loop
Gene family MIPF0000113; mir-188
Literature search

2 open access papers mention bta-mir-660
(5 sentences)

Stem-loop
   cugcuccu     c   -c    u      c    c   gaau 
5'         ucucc gua  ccau gcauau ggag ugu    u
           ||||| |||  |||| |||||| |||| |||    c
3'         ggagg cau  ggua cgugua ccuc acg    u
   -------g     a   ua    -      u    c   aaac 
Get sequence
Deep sequencing
100103 reads, 1.47e+03 reads per million, 77 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chrX: 93950762-93950841 [+]
intergenic
Clustered miRNAs
< 10kb from bta-mir-660
bta-mir-502a-2chrX: 93942730-93942819 [+]
bta-mir-502bchrX: 93946864-93946946 [+]
bta-mir-362chrX: 93947354-93947418 [+]
bta-mir-500chrX: 93948610-93948693 [+]
bta-mir-660chrX: 93950762-93950841 [+]
bta-mir-502a-1chrX: 93952708-93952792 [+]
Database links

Mature sequence bta-miR-660

Accession MIMAT0004344
Sequence

16 - 

uacccauugcauaucggagcug

 - 37

Get sequence
Deep sequencing100088 reads, 77 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1