Stem-loop sequence bta-mir-374a

AccessionMI0005466 (change log)
Previous IDsbta-mir-374
DescriptionBos taurus miR-374a stem-loop
Gene family MIPF0000288; mir-374
Literature search

4 open access papers mention bta-mir-374a
(5 sentences)

Stem-loop
        c   c                        u 
5' uacau ggc auuauaauacaaccugauaagugu a
   ||||| ||| ||||||||||||||||||||||||  
3' augug cug uaauguuauguuggacuauucacg c
        u   u                        a 
Get sequence
Deep sequencing
13396 reads, 103 reads per million, 73 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chrX: 82917566-82917637 [+]
intergenic
Clustered miRNAs
< 10kb from bta-mir-374a
bta-mir-374achrX: 82917566-82917637 [+]
bta-mir-374cchrX: 82917575-82917626 [-]
bta-mir-545chrX: 82917716-82917821 [+]
Database links

Mature sequence bta-miR-374a

Accession MIMAT0004342
Previous IDsbta-miR-374
Sequence

12 - 

uuauaauacaaccugauaagug

 - 33

Get sequence
Deep sequencing5355 reads, 73 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1