Stem-loop sequence bta-mir-34a

AccessionMI0005464 (change log)
DescriptionBos taurus miR-34a stem-loop
Gene family MIPF0000039; mir-34
Literature search

20 open access papers mention bta-mir-34a
(79 sentences)

Stem-loop
   gg -    u   -  ug     uu        -   a          guga   a 
5'   c cagc gug ag  uuucu  ggcagugu cuu gcugguuguu    gua u
     | |||| ||| ||  |||||  |||||||| ||| ||||||||||    |||  
3'   g guug cac uc  gaaga  ccgucaua gaa cgacuaacga    cgu a
   gg u    -   g  gu     uc        u   -          agga   a 
Get sequence
Deep sequencing
1471 reads, 4.29 reads per million, 70 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr16: 45359550-45359656 [+]
intergenic
Database links

Mature sequence bta-miR-34a

Accession MIMAT0004340
Sequence

22 - 

uggcagugucuuagcugguugu

 - 43

Get sequence
Deep sequencing1409 reads, 70 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1