Stem-loop sequence bta-mir-331

AccessionMI0005463 (change log)
DescriptionBos taurus miR-331 stem-loop
Gene family MIPF0000199; mir-331
Literature search

3 open access papers mention bta-mir-331
(12 sentences)

Stem-loop
   gaguuugguuuugu       u        u    u       au ccaga 
5'               uuggguu guucuagg augg cccaggg  c     u
                 ||||||| |||||||| |||| |||||||  |     c
3'               aauccaa caagaucc uauc ggguccc  g     a
   --------------       c        -    c       cg accaa 
Get sequence
Deep sequencing
13595 reads, 27.8 reads per million, 72 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr5: 25155269-25155358 [+]
sense
ENSBTAT00000042367 ; bta-mir-331-201; exon 1
Database links

Mature sequence bta-miR-331-5p

Accession MIMAT0026716
Sequence

25 - 

ucuagguauggucccagg

 - 42

Get sequence
Deep sequencing981 reads, 67 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence bta-miR-331-3p

Accession MIMAT0004339
Sequence

61 - 

gccccugggccuauccuagaa

 - 81

Get sequence
Deep sequencing11923 reads, 71 experiments
Evidence experimental; cloned [1], Illumina [2]
Predicted targets

References

1
2