Stem-loop sequence bta-mir-204

AccessionMI0005462 (change log)
DescriptionBos taurus miR-204 stem-loop
Gene family MIPF0000042; mir-204
Literature search

8 open access papers mention bta-mir-204
(18 sentences)

Stem-loop
   uuucuucau     ucg     u          a     u    gagaau 
5'          gugac   uggac ucccuuuguc uccua gccu      a
            |||||   ||||| |||||||||| ||||| ||||      u
3'          uacug   acuug agggaaacgg agggu cgga      a
   ------cac     uua     c          a     -    ggaagu 
Get sequence
Deep sequencing
42386 reads, 366 reads per million, 64 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr8: 47411234-47411329 [-]
sense
ENSBTAT00000061517 ; TRPM3-201; intron 6
ENSBTAT00000010240 ; TRPM3-202; intron 7
Database links

Mature sequence bta-miR-204

Accession MIMAT0004338
Sequence

23 - 

uucccuuugucauccuaugccu

 - 44

Get sequence
Deep sequencing42363 reads, 64 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1