Stem-loop sequence bta-mir-19b

AccessionMI0005461 (change log)
DescriptionBos taurus miR-19b stem-loop
Gene family MIPF0000011; mir-19
Literature search

10 open access papers mention bta-mir-19b
(46 sentences)

Stem-loop
        uu                 -  -      uc    ugugu 
5' cacug  cuaugguuaguuuugca gg uuugca  cagc     g
   |||||  ||||||||||||||||| || ||||||  ||||     a
3' gugau  ggugucagucaaaacgu cc aaacgu  gucg     u
        --                 a  u      --    ucuua 
Get sequence
Deep sequencing
32706 reads, 387 reads per million, 76 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr12: 66421815-66421901 [+]
intergenic
Clustered miRNAs
< 10kb from bta-mir-19b
bta-mir-17chr12: 66421236-66421319 [+]
bta-mir-18achr12: 66421379-66421449 [+]
bta-mir-19achr12: 66421518-66421599 [+]
bta-mir-20achr12: 66421687-66421757 [+]
bta-mir-19bchr12: 66421815-66421901 [+]
bta-mir-92a-1chr12: 66421937-66422014 [+]
Database links

Mature sequence bta-miR-19b

Accession MIMAT0004337
Sequence

54 - 

ugugcaaauccaugcaaaacuga

 - 76

Get sequence
Deep sequencing65402 reads, 76 experiments
Evidence experimental; cloned [2]
Predicted targets

References

1
2