Stem-loop sequence bta-mir-19a

AccessionMI0005460 (change log)
DescriptionBos taurus miR-19a stem-loop
Gene family MIPF0000011; mir-19
Literature search

13 open access papers mention bta-mir-19a
(34 sentences)

Stem-loop
       u  u                 --      ---    ag 
5' gcag cc cuguuaguuuugcauag  uugcac   uaca  a
   |||| || |||||||||||||||||  ||||||   ||||  a
3' cguc gg gguagucaaaacguauc  aacgug   augu  g
       c  u                 ua      uug    aa 
Get sequence
Deep sequencing
30831 reads, 308 reads per million, 76 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr12: 66421518-66421599 [+]
intergenic
Clustered miRNAs
< 10kb from bta-mir-19a
bta-mir-17chr12: 66421236-66421319 [+]
bta-mir-18achr12: 66421379-66421449 [+]
bta-mir-19achr12: 66421518-66421599 [+]
bta-mir-20achr12: 66421687-66421757 [+]
bta-mir-19bchr12: 66421815-66421901 [+]
bta-mir-92a-1chr12: 66421937-66422014 [+]
Database links

Mature sequence bta-miR-19a

Accession MIMAT0004336
Sequence

49 - 

ugugcaaaucuaugcaaaacuga

 - 71

Get sequence
Deep sequencing30766 reads, 76 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1