Stem-loop sequence bta-mir-15a

AccessionMI0005458 (change log)
DescriptionBos taurus miR-15a stem-loop
Gene family MIPF0000006; mir-15
Literature search

17 open access papers mention bta-mir-15a
(31 sentences)

Stem-loop
        gaguaaa ua        ua          ga  u 
5' ccuug       g  gcagcaca  augguuugug  uu u
   |||||       |  ||||||||  ||||||||||  || g
3' ggaac       c  cgucgugu  uaccggacgu  aa a
        auaaaaa uc        ua          gg  a 
Get sequence
Deep sequencing
27318 reads, 361 reads per million, 75 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr12: 19660532-19660614 [-]
intergenic
Clustered miRNAs
< 10kb from bta-mir-15a
bta-mir-15achr12: 19660532-19660614 [-]
bta-mir-16achr12: 19660386-19660474 [-]
Database links

Mature sequence bta-miR-15a

Accession MIMAT0004334
Sequence

14 - 

uagcagcacauaaugguuugu

 - 34

Get sequence
Deep sequencing27283 reads, 75 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1