|
miRBase |
|
Stem-loop sequence bta-mir-125b-2 |
|||||
| Accession | MI0005457 | ||||
| Description | Bos taurus miR-125b-2 stem-loop | ||||
| Gene family | MIPF0000017; mir-125 | ||||
| Stem-loop |
--ga uu uc ug c a - g u cuu ccuag cc aga ccu acuuguga g uau u ||| ||||| || ||| ||| |||||||| | ||| gag ggauc gg ucu gga ugaacacu c aug u aggg gc ca gu c c a g a |
||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence bta-miR-125b |
|
| Accession | MIMAT0003539 |
| Sequence |
13 - ucccugagacccuaacuuguga - 34 |
| Evidence | experimental; cloned [1-2] |
| Predicted targets |
|
References |
|
| 1 |
PMID:17306260
"Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland"
FEBS Lett. 581:981-988(2007).
|
| 2 |
PMID:19267191
"Identification and characteristics of cattle microRNAs by homology searching and small RNA cloning"
Biochem Genet. 47:329-343(2009).
|