Stem-loop sequence bta-mir-125b-2

AccessionMI0005457 (change log)
DescriptionBos taurus miR-125b-2 stem-loop
Gene family MIPF0000033; mir-10
Literature search

35 open access papers mention bta-mir-125b-2
(118 sentences)

Stem-loop
   --ga   uu     uc  ug   c   a        - g   u 
5'     cuu  ccuag  cc  aga ccu acuuguga g uau u
       |||  |||||  ||  ||| ||| |||||||| | |||  
3'     gag  ggauc  gg  ucu gga ugaacacu c aug u
   aggg   gc     ca  gu   c   c        a g   a 
Get sequence
Deep sequencing
178856 reads, 1.63e+03 reads per million, 78 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr1: 19935732-19935816 [-]
intergenic
Database links

Mature sequence bta-miR-125b

Accession MIMAT0003539
Sequence

13 - 

ucccugagacccuaacuuguga

 - 34

Get sequence
Deep sequencing321610 reads, 77 experiments
Evidence experimental; cloned [1-2]
Predicted targets

References

1
2