Stem-loop sequence bta-mir-103-2

AccessionMI0005456 (change log)
DescriptionBos taurus miR-103-2 stem-loop
Gene family MIPF0000024; mir-103
Literature search

34 open access papers mention bta-mir-103-2
(215 sentences)

Stem-loop
   uugug      --   u  u           ----    ua 
5'      cuuuca  gcu cu uacagugcugc    cuug  g
        ||||||  ||| || |||||||||||    ||||  c
3'      gaaagu  cgg ga auguuacgacg    ggac  a
   --caa      au   -  c           aacu    uu 
Get sequence
Deep sequencing
228146 reads, 1.52e+03 reads per million, 78 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr13: 51962355-51962430 [-]
sense
ENSBTAT00000042172 ; bta-mir-103-2-201; exon 1
ENSBTAT00000045589 ; PANK2-201; intron 5
Database links

Mature sequence bta-miR-103

Accession MIMAT0003521
Sequence

48 - 

agcagcauuguacagggcuauga

 - 70

Get sequence
Deep sequencing456125 reads, 78 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1