|
miRBase |
|
Stem-loop sequence MI0005456 |
|||||
| Accession | MI0005456 | ||||
| ID | bta-mir-103-2 | ||||
| Description | Bos taurus miR-103-2 stem-loop | ||||
| Stem-loop |
uugug -- u u ---- ua
cuuuca gcu cu uacagugcugc cuug g
|||||| ||| || ||||||||||| |||| c
gaaagu cgg ga auguuacgacg ggac a
--caa au - c aacu uu
|
||||
| Genome context |
|
||||
| Database links |
|
||||
| Gene family |
MIPF0000024; mir-103 |
||||
Mature sequence MIMAT0003521 |
|
| Accession | MIMAT0003521 |
| ID | bta-miR-103 |
| Sequence |
48 - agcagcauuguacagggcuauga - 70 |
| Evidence | experimental; cloned [1] |
| Predicted targets |
|
References |
|
| 1 |
"Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland"
FEBS Lett. 581:981-988(2007).
|