Stem-loop sequence bta-let-7c

AccessionMI0005454 (change log)
DescriptionBos taurus let-7c stem-loop
Gene family MIPF0000002; let-7
Literature search

52 open access papers mention bta-let-7c
(219 sentences)

Stem-loop
     a      uu   g   u             ua  g ua a 
5' gc uccggg  gag uag agguuguaugguu  ga u  c c
   || ||||||  ||| ||| |||||||||||||  || |  | c
3' cg agguuc  uuc auc uccaacaugucaa  uu a  g c
     -      cu   g   u             --  g gg u 
Get sequence
Deep sequencing
7121101 reads, 3.24e+04 reads per million, 78 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr1: 19984844-19984927 [-]
sense
ENSBTAT00000042291 ; bta-let-7c-201; exon 1
Clustered miRNAs
< 10kb from bta-let-7c
bta-mir-99achr1: 19985570-19985650 [-]
bta-let-7cchr1: 19984844-19984927 [-]
Database links

Mature sequence bta-let-7c

Accession MIMAT0004332
Sequence

11 - 

ugagguaguagguuguaugguu

 - 32

Get sequence
Deep sequencing7121024 reads, 78 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1