Stem-loop sequence bta-let-7b

AccessionMI0005453 (change log)
DescriptionBos taurus let-7b stem-loop
Gene family MIPF0000002; let-7
Literature search

53 open access papers mention bta-let-7b
(227 sentences)

Stem-loop
   cgg  u                     ucaggguagugaug 
5'    gg gagguaguagguugugugguu              u
      || |||||||||||||||||||||              u
3'    cc uuccgucauccaacauaucaa              g
   ---  -                     uagaaggcuccccc 
Get sequence
Deep sequencing
3777939 reads, 1.68e+04 reads per million, 77 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The 3' end of the bovine let-7b hairpin precursor falls in a gap in the genome assembly. The sequence shown here is predicted from human.

Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr5: 117458606-117458686 [+]
antisense
ENSBTAT00000050917 ; bta-mir-3596-201; exon 1
Clustered miRNAs
< 10kb from bta-let-7b
bta-let-7a-3chr5: 117457806-117457879 [+]
bta-mir-2443chr5: 117458061-117458133 [+]
bta-let-7bchr5: 117458606-117458686 [+]
bta-mir-3596chr5: 117458609-117458691 [-]
Database links

Mature sequence bta-let-7b

Accession MIMAT0004331
Sequence

6 - 

ugagguaguagguugugugguu

 - 27

Get sequence
Deep sequencing3777147 reads, 77 experiments
Evidence experimental; cloned [1-2]
Predicted targets

References

1
2
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).