Stem-loop sequence bta-let-7a-2

AccessionMI0005451 (change log)
DescriptionBos taurus let-7a-2 stem-loop
Gene family MIPF0000002; let-7
Literature search

63 open access papers mention bta-let-7a-2
(270 sentences)

Stem-loop
      uu   g   u             uagaa ua a 
5' agg  gag uag agguuguauaguu     u  c u
   |||  ||| ||| |||||||||||||     |  | c
3' ucc  uuc auc uccgacaugucaa     a  g a
      -u   g   c             --uag gg a 
Get sequence
Deep sequencing
7464413 reads, 3.42e+04 reads per million, 78 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr15: 33533448-33533519 [-]
sense
ENSBTAT00000042260 ; bta-let-7a-2-201; exon 1
Clustered miRNAs
< 10kb from bta-let-7a-2
bta-mir-100chr15: 33539274-33539349 [-]
bta-let-7a-2chr15: 33533448-33533519 [-]
Database links

Mature sequence bta-let-7a-5p

Accession MIMAT0003844
Previous IDsbta-let-7a
Sequence

5 - 

ugagguaguagguuguauaguu

 - 26

Get sequence
Deep sequencing22388600 reads, 78 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1